Query (optional)   in Class  

GrainGenes Sequence Report: EF051701

[ Printable Version ]  [ Submit comment/correction ]

Sequence
EF051701
Subsequence
EF051701_1.cds12625
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops tauschii
Species
Aegilops tauschii
Chromosome
1
Data Source
genbankDownloaded 2008-2009
Title
Aegilops tauschii high molecular weight glutenin subunit (1Dx1.1t) gene, complete cds.
Strain
RM0169
Gene
1Dx1.1t
Gene Product
high molecular weight glutenin subunit
Remark
DB_xref: taxon:37682
Feature: source: mol_type = 'genomic DNA'; map = '1D'
EMBL Feature
feature_gene12625Location: <1..>2625
DNA
atggctaagcggttggtccactttgtggcggtagtcgtcgccctcgtggc
tctcaccgtcgctgaaggtgaggcctctgggcaactacagtgtgagcgcg
agctccaggagcgcgagctcaaggcatgccagcaggtcatggaccagcag
ctccgagacattagccccaagtgccaccccgttgtcgtcagcccagtcgc
gggacaatacgagcaacaaatcgtggtgccgcccaagggcggatctttct
accccggcgagaccacgccaccgcagcaactccaacaaagtatattttgg
ggaatacctgcactactaaaaaggtattacccaagtgtaacttctccgca
gcaggtttcatactatccaggccaagcttctccgcaacggccaggacaag
gtcagcagccaggacaagggcaacaatcagtacaagaacaacaagggtac
tactcaacttctccgcaacagccaggacaatggcaacaaccggaacaagg
gcaaccaggatactacccaacttctctgcagcagccaggacaattgcaac
aaccagcacaagggcaacaaggacagcaatcaggacaagggcaacaaggt
cagcaaccaggacaagggcaaccagggtactacccaacttctttgcagct
gcagccaggacaattgcaacaaccagcacaagggcaacaagggcagcaac
caggacaagggcaacaaggtcaacagtcaggacaagggaaacaatcagga
caagggcaacaaggtcaacagccaggacaagggcaacaaggtcagcagct
cggacaaggacaagggtactacccaacttctctgcaacagtccggacaag
ggcaaccagggtactacccaacttttctgcagcagccaggacaatggcaa
tcagggtactacccaacttctccgcagcaaccaggacaagggcaacagcc
agaacaattgcaacaaccagcacaagggcagcaaccaggacaaggacaac
aaggtcagcagccagcacaagggcaacaagggcaacaaggtcagcagcca
gcacaagggcaacaaggtcagcagccagcacaagggcaacaagggcaaca
aggtcagcagccagcacaagggcaacaagggcaacaaggccagcagccag
cacaagggcagcaaccgggacaagggcagctagggtactacccaacttct
ccgcaacagtcaggacaagggcaaccagggtattacccaacttcttcgca
gcaaccaggacaatcgcagcaaccaggacaagggaaacaaggtcagcagc
taggacaagggcaacaagctcagcagccaggacaagggcagcaaccagga
caagggcagtcgggatactacccaacttcttcgcagcagtcaggacaagg
gcaaccagggtactacctaacttctccgcagcagccaggacaagggcagc
agccaggacaattgcaacaatcagcacaagggcaagaaggacagcaacca
ggacaagggcaacaaggtcagcagccaggacaagggcaacaaggtcagct
gccaggacaagggcaacagggtcagcagccgggacagggacagccagggt
actacccaacttctccgcaggagtcaggacaagggcaacagccaggacaa
tggcaacaatcaggacaagggcaaccagggtactacccaacttctccgtt
gcagccaggacaagggcaaccagggtacaacccaacttctccacaacagc
caggacaagggcagcagccaggacaattgcaacaaccaacacaagagcaa
caagggcagcaactagcacaagggcagcaaccaacacaagggcaacaagg
tcaacagccaggacaagggcaacaaggtcagcagccaggacaagggcaac
aagggcagcagccaggacaagagcagcaaccagcacaagggcaacaaggt
caacagccagcacaagggcaacaaggtcagcagccaggacaagggcagca
accgggacaacggcaaccagggtactacccaacttctccgcaggagtcag
gacaagggcaacagccaggacattggcaacaaccaggacaagggcaacca
gggtactacctgacttctctgttgcagccaggacaagggcaacaagggta
ctacccaacttctctgcagcaactaggacaagggcagcaaccaggacaat
ggcaacaatcaggacaagggcaacaagggtactacacaacttctccgcag
ctgtcaggacaagggcaacagctaggacaatggctgcaactaggacaagg
gcaacagccaggacaatggctgcaaccaggacaagggcaacaagggtact
acccaacttctccgcaacagtcgggacaagggcaacagccaggacaatgg
ctgcaaccaggacaagggcaacaagtgtactacccaacttctccgcaaca
gccaggacaagggcagcaatcaggacaagggcaacaaggctactacagct
cataccatgttagcgcggagcaccaggcggccagcctaaaggtggcaaag
gcgcagcagctcgcggcacagctgccggcaatgtgccggctggagggcgg
cgacgcattgtcggccagccagtgatag
BLAST
BLAST Search