Query (optional)   in Class  

GrainGenes Sequence Report: EF095061

[ Printable Version ]  [ Submit comment/correction ]

Sequence
EF095061
Subsequence
EF095061_1.cds1540
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Cultivar
A4
Chromosome
1
Data Source
genbankDownloaded 2008-2009
Title
Triticum aestivum strain CRB-INRA-CFD-748 11B protein (11B) gene, partial cds.
Strain
CRB-INRA-CFD-748
Gene
11B
Gene Product
11B protein
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA'; map = '1BS';
Note: genotype: AE1
EMBL Feature
feature_gene1692Location: <1..>692
DNA
tgagctgatgagggttcggttcaggtgattaagccgtttcctgtcatgct
ttctactcccaagtttgctttgcaatttgcgcatgcaaacatctcactga
atactcatgagtgcaatatgctagttacttgattagtcattggacaatat
tttaccgtcctgtgagttcatatgcaacaataggtctgacagttcattta
gtttataatcatatttagagcacttcaggttatcttttccacattaaaca
ctgtcggaaaaggagaactccaggttatcgtgttcacattaaacacagtt
ctgtttcagtctgtagctgagcttctgctctactgacaactgacaagcct
atatttcattgcaaaacattaatagcgttggcatcttccttctgagatat
ttttaatttgcagcaaaacgcgctttggggagcatcaggctgagaattgg
tggaaagagaatcgcgagaaggtttatgagcgatacaacgtgaggacctc
ccaacgagcgtcgtcagcagcctcgacccactcggcctaataacgtacct
tcctgtttcttcacgcacaaactgcaaggccagccatcaatgagcagcag
catatcgtgaacgaaactaagggttatgtcatatgtgtactggggtgtag
acccgccatatgtgatctttatcgtctcttgatactgtgata
BLAST
BLAST Search