Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c26158_622

[Submit comment/correction]

Sequence
Ex_c26158_622
Contig
3B_10569740
Probe
Ex_c26158_622
DNA Homology
3B_10569740Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443B_10569740Best IWGSC match
DNA
atacccctatcctgcttaaggttagctgctgaaagaggtactattctttt
Rtacaactcacctagagataaaacatttcccccccatacaacacagaggc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.