Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c31068_323

[Submit comment/correction]

Sequence
Ex_c31068_323
Contig
6DL_3229418
Species
Triticum aestivum
Probe
Ex_c31068_323
DNA
tccacttcctgatcaatatgctctcgaagaaggcgatgaaccatatgaaa
Rtgcagttcatgtggtaccacgagatattgctgttgtaccttagtaggag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.