Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c449_423

[Submit comment/correction]

Sequence
Ex_c449_423
Contig
6AL_5834254
Probe
Ex_c449_423
DNA Homology
6AL_5834254Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5834254Best IWGSC match
DNA
actagcggtgcttttgatctcggaatagaaaatctccccagcctccttaa
Ratcagatgtgtactatggggatacgtggacgatatcagcagagttgagg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.