Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c5231_1655

[Submit comment/correction]

Sequence
Ex_c5231_1655
Contig
7DS_3964869
Probe
Ex_c5231_1655
DNA Homology
7DS_3964869Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447DS_3964869Best IWGSC match
DNA
ccatggtatcgcatggcacctcccccccttctgcaaagacttgaattctc
Rccacacagctgctgcatattctcacgaattcctccatggattgagaaac
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.