Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c5902_905

[Submit comment/correction]

Sequence
Ex_c5902_905
Contig
5AS_1548220
Probe
Ex_c5902_905
DNA Homology
5AS_1548220Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AS_1548220Best IWGSC match
DNA
acgactactctgtatgcacctatagataacatcgactactctgtatgcac
Mtgatattaactttcctataaaataaatatacacatataacaatacttac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.