Query (optional)   in Class  

GrainGenes Sequence Report: Ex_c9327_1198

[Submit comment/correction]

Sequence
Ex_c9327_1198
Contig
5AL_2773625
Probe
Ex_c9327_1198
DNA Homology
5AL_2773625Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-425AL_2773625Best IWGSC match
DNA
atagaaatgagtataccactagaccatgtcaaacacaaatgctttgttca
Rtttcattttctgtatttatcatttttgtatgcagaaggagtcatgtcga
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.