Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c101903_287

[Submit comment/correction]

Sequence
Excalibur_c101903_287
Contig
1BS_3436400
Probe
Excalibur_c101903_287
DNA Homology
1BS_3436400Best IWGSC match1741.99993e-41URGI_BestIWGSC_N
BLAST, e-value
1.99993e-411BS_3436400Best IWGSC match
DNA
caatgctgtctctggcaatgacacggccatagacatcgactgggaagcct
Rcatctgaggagactatgctgaycgagaggatgtttgcagagtcttctag
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.