Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c11031_129

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Excalibur_c11031_129
Contig
2DL_9894863
Species
Triticum aestivum
Probe
Excalibur_c11031_129
DNA
aaccatcgaaactccccagatctcacgctcttgccgtactccctcccttt
Rtcctccgtcctgtagagcatctggccgacattgccgtcctgggcgggcg
a
BLAST
BLAST Search