Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c11455_93

[Submit comment/correction]

Sequence
Excalibur_c11455_93
Contig
6DS_2106769
Probe
Excalibur_c11455_93
DNA Homology
6DS_2106769Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-426DS_2106769Best IWGSC match
DNA
ccatagaaacagaagagcagccaccggcggcaggagtagagaagctgctg
Mtgatgattgtcgccggatcgccatcgctgctgctgccgccgccggtaac
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.