Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c12376_569

[Submit comment/correction]

Sequence
Excalibur_c12376_569
Contig
1BS_3451992
Probe
Excalibur_c12376_569
DNA Homology
1BS_3451992Best IWGSC match1451e-32URGI_BestIWGSC_N
BLAST, e-value
1e-321BS_3451992Best IWGSC match
DNA
tcttgcaaatgcgtaaacaaaaccttgagattgccaacaattgattgagc
Rtcatgaacagaaggctgcagattatattccgacagaataggcaataaag
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.