Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c14911_546

[Submit comment/correction]

Sequence
Excalibur_c14911_546
Contig
1DL_2274561
Species
Triticum aestivum
Probe
Excalibur_c14911_546
DNA
ggggtaacaaaacaacatctgcagctgttgatatatggaacaacagcact
Rcacaaaaggaaagctccaccgacaatgcctggggtaaagaagccggagg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.