Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c15095_852

[Submit comment/correction]

Sequence
Excalibur_c15095_852
Contig
3B_10414385
Probe
Excalibur_c15095_852
DNA Homology
3B_10414385Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443B_10414385Best IWGSC match
DNA
gtctagatgtgtgtttcacttgaacgatgcagaagtgtgctggctatgag
Rctcacagtcttcgtgggcgtgagtggctgaattcaggtctcttgattct
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.