Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c15280_1242

[Submit comment/correction]

Sequence
Excalibur_c15280_1242
Contig
4BS_4922876
Probe
Excalibur_c15280_1242
DNA Homology
4BS_4922876Best IWGSC match1451e-32URGI_BestIWGSC_N
BLAST, e-value
1e-324BS_4922876Best IWGSC match
DNA
tagcttcatgtccatgtgttccctgggtttggccgtggacgccgaattca
Rggccgagatatatacttgtagagcatttcagcctcctcatagttatcag
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.