Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c17004_1098

[Submit comment/correction]

Sequence
Excalibur_c17004_1098
Contig
1DL_13206
Probe
Excalibur_c17004_1098
DNA Homology
1DL_13206Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_13206Best IWGSC match
DNA
aaggagagaccaccacaagcaatgtctgctgaagctggagatgcagcagc
Rcctgctcctgaaactggaaatgcgacgcttgcttctgaaactggagatg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.