Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c19658_82

[Submit comment/correction]

Sequence
Excalibur_c19658_82
Contig
3AS_3351719
Probe
Excalibur_c19658_82
DNA Homology
3AS_3351719Best IWGSC match1803.9937e-43URGI_BestIWGSC_N
BLAST, e-value
3.9937e-433AS_3351719Best IWGSC match
DNA
gaaactgttgttgaagtaggctcacagtagatggtggcacggacctgcac
Ragacaagagaaatgctggataccaagcacaaagtgatctgtatcctcca
n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.