Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c20610_149

[Submit comment/correction]

Sequence
Excalibur_c20610_149
Contig
1BS_3428510
Probe
Excalibur_c20610_149
DNA Homology
1BS_3428510Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441BS_3428510Best IWGSC match
DNA
accatcctcaggtgcgccgacactccggcgaagtactttgccaaggtcct
Rcacaaggcgatgaaaggcctgggcaccagcaacgcggcgctcatacggg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.