Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c22321_761

[Submit comment/correction]

Sequence
Excalibur_c22321_761
Contig
5BL_10814004
Species
Triticum aestivum
Probe
Excalibur_c22321_761
DNA
GCCAAAGCCGGCATCCTGGATTGGCCAACGAGGTATAAGATCGCGGTCCA
YGCCGCCGAGGGCCTCTCCTACTTGCACCATGACTGCGTGCCCTCGATCG
T
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.