Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c24715_276

[Submit comment/correction]

Sequence
Excalibur_c24715_276
Contig
2DL_9778659
Probe
Excalibur_c24715_276
DNA Homology
2DL_9778659Best IWGSC match1111e-22URGI_BestIWGSC_N
BLAST, e-value
1e-222DL_9778659Best IWGSC match
DNA
ccatccttgaccatattcatgaaaatataaaggatgatcagcacaaatca
Matgaacaaggtgatggagactgttgcattgcacaccgggtgttttctgg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.