Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c25390_2483

[Submit comment/correction]

Sequence
Excalibur_c25390_2483
Contig
6AL_5833814
Probe
Excalibur_c25390_2483
DNA Homology
6AL_5833814Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5833814Best IWGSC match
DNA
agacgttttgcttcagcaaacttctcgcggacaagggacattctcctctc
Rcaagaaggatcatttccttggtgtctgttcttgctgctatcgatcttcg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.