Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c25781_232

[Submit comment/correction]

Sequence
Excalibur_c25781_232
Contig
2DL_9878493
2BL_8005433
Species
Triticum aestivum
Probe
Excalibur_c25781_232
DNA Homology
2DL_9878493Best IWGSC match1673e-39URGI_BestIWGSC_N
BLAST, e-value
3e-392DL_9878493Best IWGSC match
DNA
gtgctgtacttgcacacgtaatgctgcgtgagaagctgcacatattcggc
Rttctcggatgcgtcctatgtgtcgtgggatccaccaccattgtccttca
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.