Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c28325_140

[Submit comment/correction]

Sequence
Excalibur_c28325_140
Contig
2AL_3552825
Probe
Excalibur_c28325_140
DNA Homology
2AL_3552825Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442AL_3552825Best IWGSC match
DNA
tggagcttttccgttcgttgcgtcctttaattttttgctctttgcgcctc
Ratcatcatatggaagcttgtccctgctggtagtaggtctacctggttta
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.