Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c33709_68

[ Submit comment/correction ]

Sequence
Excalibur_c33709_68
Contig
6DL_140112
Species
Triticum aestivum
Probe
Excalibur_c33709_68
DNA
tttcttgttttgatgcaacaggagaacgttggcgtgtccgttttgcatcc
Rtacttggcatggatactgagaaaagactttcaagctcagacagatcaat
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.