Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c44739_232

[Submit comment/correction]

Sequence
Excalibur_c44739_232
Contig
6AL_5815310
Species
Triticum aestivum
Probe
Excalibur_c44739_232
DNA
atgttgcctcttgctgccacaaaggccgccatcttttcctgggctttccc
Rttccatctgcagaacctgtgccttgcttgtggcatgacctcggctattg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.