Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c45372_537

[Submit comment/correction]

Sequence
Excalibur_c45372_537
Contig
6BL_4394383
Probe
Excalibur_c45372_537
DNA Homology
6BL_4394383Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-416BL_4394383Best IWGSC match
DNA
catcaggcaccatagggtatgtcattctttgtattatatctttgctcacc
Rcatcatagctcctgaaattatctattcttgcagcatagctggagcgtat
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.