Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c46878_419

[Submit comment/correction]

Sequence
Excalibur_c46878_419
Contig
4BS_4874366
Probe
Excalibur_c46878_419
DNA Homology
4BS_4874366Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444BS_4874366Best IWGSC match
DNA
gatacccaggacacacgtcaacaggcaaacgataatgttggtcttcagcg
Rattggagatgcagcaacagggtcagattatggaagcaatgctccgagta
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.