Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c52196_235

[Submit comment/correction]

Sequence
Excalibur_c52196_235
Contig
6AL_5827338
Probe
Excalibur_c52196_235
DNA Homology
6AL_5827338Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5827338Best IWGSC match
DNA
atgatgatgatgggcgcgccgtcgctccatcgccaggcgtcctccaaccc
Rtcgctccatcgccaggcgtcctccaacccgtcgctccatcgccaggcgt
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.