Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c53111_215

[Submit comment/correction]

Sequence
Excalibur_c53111_215
Contig
7BS_3069924
Probe
Excalibur_c53111_215
DNA Homology
7BS_3069924Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BS_3069924Best IWGSC match
DNA
ctttcaacacagccaatgggagaattagggccaggcagatgatgtctggt
Ratgaacttatgatgtctggggaaggtcggagctttgtggatggtgacat
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.