Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c53454_294

[Submit comment/correction]

Sequence
Excalibur_c53454_294
Contig
5BL_10787428
Probe
Excalibur_c53454_294
DNA Homology
5BL_10787428Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-425BL_10787428Best IWGSC match
DNA
aaactcggtgtatcctacacgagtcccgagggacatctgcagcggagcac
Rgaagcgcgtccgtacccggctcatgctcatccaatgtgactggagacac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.