Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c58747_289

[Submit comment/correction]

Sequence
Excalibur_c58747_289
Contig
6BL_4321089
Probe
Excalibur_c58747_289
DNA Homology
6BL_4321089Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BL_4321089Best IWGSC match
DNA
ttcctggcaacctgttcaacaatgttgatttcccaaacaaaggacacacc
Rcaaaacaacacatgcatctccactttttatcacattgcatccctcacca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.