Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c63045_203

[Submit comment/correction]

Sequence
Excalibur_c63045_203
Contig
5AS_1490385
Species
Triticum aestivum
Probe
Excalibur_c63045_203
DNA
atgacaatatacagactccccatgcctagtgtagtgtaggcagcgttccc
Rgtgtcttggaaccagtgtgcaaagaatgaatggttgcaacttgagacca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.