Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c6326_77

[Submit comment/correction]

Sequence
Excalibur_c6326_77
Contig
6AS_4364227
Probe
Excalibur_c6326_77
DNA Homology
6AS_4364227Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-416AS_4364227Best IWGSC match
DNA
catactttgacgcagcagcggtagacttggctgcagctcgcttggcagcc
Rcggcctcttcaggtgtggtagcggtttcagccttcttggtgaacatctt
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.