Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c6894_792

[Submit comment/correction]

Sequence
Excalibur_c6894_792
Contig
2AL_6379757
Species
Triticum aestivum
Probe
Excalibur_c6894_792
DNA
atggcgaaacaattattactgccggataatcagttcgatcatggcaccgt
Mtcatggtgagataatcatgtaagctgtaagattagtctgcattgtctct
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.