Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_c8919_345

[Submit comment/correction]

Sequence
Excalibur_c8919_345
Contig
2BL_8089009
Probe
Excalibur_c8919_345
DNA Homology
2BL_8089009Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BL_8089009Best IWGSC match
DNA
accgtgttatcaccgggtttacctatttgatgggcttggggagggagccc
Rttagaccaagcagacgtgacagaagtcggtgtctgagaataatgaatgg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.