Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_rep_c102020_253

[Submit comment/correction]

Sequence
Excalibur_rep_c102020_253
Contig
5DL_22067
Probe
Excalibur_rep_c102020_253
DNA Homology
5DL_22067Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DL_22067Best IWGSC match
DNA
ctaaaaccgcctgtcagccaccttccagcaggcacaaagagctgcgcgcc
Rcccttgtccgcaaatgaattgaggtagaagatggcattctggaatgctt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.