Query (optional)   in Class  

GrainGenes Sequence Report: Excalibur_rep_c68588_1196

[Submit comment/correction]

Sequence
Excalibur_rep_c68588_1196
Contig
4BS_4909772
Probe
Excalibur_rep_c68588_1196
DNA Homology
4BS_4909772Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444BS_4909772Best IWGSC match
DNA
acaatcaagctgcaccggcattgccttggccgccatccggagcactttcc
Rttgtcctagatgagccgctgcgcgagagttgggatgccacggtgctggg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.