Query (optional)   in Class  

GrainGenes Sequence Report: FB814572

[ Printable Version ]  [ Submit comment/correction ]

Sequence
FB814572
Subsequence
FB814572_1.cds11725
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Species
Avena sativa
Data Source
genbankDownloaded 2008-2009
Title
Sequence 33845 from Patent WO2008034648.
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'unassigned DNA';
DNA
atggctctcctttgttcagccctgagtaacagcacccatccttcctttag
aagccacataggagcaaatagtgagaatttatggcacctctctgctgatc
cagcacaaaagagtaagagaaggtgtaaccttacacttagttcacgagca
gcaagaataagcagtgcgcttgaaagtgcaaagcaggtgaagccatggca
agtccctaaaagggactggttcccccctgagtttatgttcggtgccgcca
gtgcagcgtaccaaattgaaggtgcttggaatgaaggtggcaaggggcca
agctcttgggacaacttctgccacagccatcctgaccggataatggacaa
gagcaatgcggatgttgcagcaaactcctactatatgtataaagaggatg
tcaggatgctgaaggaaataggcatggactcgtataggttctcaatctct
tggccgagaatactgccaaaggggacgctggatggaggcataaaccatga
aggcatccagtactacaatgacctactcgactgcttgatagagaacggta
taaagccatatattacgcttttccactgggacacccctcaagcactagca
gatgagtacaaagacttcttagataggaggattgtaaaagattacacaga
ctacgcgacggtgtgctttgaacacttcggcgacaaggtgaagaactggt
tcacctttaacgagccacactcattttgtggtttgggctatggaacggga
ctgcatgcccctggtgcgcgttgctcggcagggatgacctgtgtcatccc
agaggaagacgccctcagaaatccatacattgttggccacaacctcctcc
tagcacatgccgagactgttgatgtttacaacaagttctataagggtgat
gatggacaaataggtatggttttggacgtgatggcttacgagccatatgg
aaacaacttcctcgatcaacaggcccaagaaagagcaattgacttccaca
tcggatggtttctagagccaatggttcgtggtgactaccccttctctatg
agatcactagtgggagaccgtctacccttctttactaagtctgagcaaga
gaagctagtgtcctcatatgatttcgtagggatcaactactacacttcta
ggtttgccaagcatattgacatttcaccggaatttataccaaagataaat
accgacgatgtctactccaatcctgaagttaacgacagcaatgggattcc
tattggtcctgatgttggaatgtattttatttattcttatccaaaagggc
taaagaacatccttctccgcatgaaggaaaaatatggaaacccaccaata
tacatcaccgagaatggaaccgcagacatggatggctggggaaacccccc
catgacagacccgttggatgacccgttaaggatagagtacctccaacaac
acatgacagcaatcaaagaagcgatagacttaggccgccggacgctgcgg
ggccacttcacatggagtctaatagacaacttcgagtggtctttgggcta
cttatcacgttttggcatcgtctacatcgaccgcaatgatggttgcaagc
gcatcatgaagaagtcagccaagtggctgaaagagttcaatggcgccacg
aagaaacttaacaacaagatccttggtgccagctcgtgttgtagtggagt
aacgcatggtggtggcaccgcgtga
BLAST
BLAST Search