Query (optional)   in Class  

GrainGenes Sequence Report: GENE-0559_171

[Submit comment/correction]

Sequence
GENE-0559_171
Contig
1DL_2283268
Species
Triticum aestivum
Probe
GENE-0559_171
DNA Homology
1DL_2283268Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_2283268Best IWGSC match
DNA
gttcagtgcaacaactttaacatgtgcactatataatataatgattaatg
Raagtgtaaaataaaatctgaaatctgaaaattttgcaaggacttgaata
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.