Query (optional)   in Class  

GrainGenes Sequence Report: GENE-3437_148

[Submit comment/correction]

Sequence
GENE-3437_148
Contig
5BL_10852753
Probe
GENE-3437_148
DNA Homology
5BL_10852753Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10852753Best IWGSC match
DNA
cgcattagctcgccaagcatgcctttacagaaacaagagtccttttactc
Rattcagagacactgtcatggcacgcctgaccctttttgtcatctaaact
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.