Query (optional)   in Class  

GrainGenes Sequence Report: GENE-4079_49

[Submit comment/correction]

Sequence
GENE-4079_49
Contig
6BS_291725
Probe
GENE-4079_49
DNA Homology
6BS_291725Best IWGSC match1803.9937e-43URGI_BestIWGSC_N
BLAST, e-value
3.9937e-436BS_291725Best IWGSC match
DNA
caaacacctctccaatctgtagctatcgaaagtctccagaaacttcagRa
ctgaccttggttcatactgacacagaagctgtgcaagaaggcgtatttg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.