Query (optional)   in Class  

GrainGenes Sequence Report: GENE-4868_140

[Submit comment/correction]

Sequence
GENE-4868_140
Contig
5BL_10920454
Probe
GENE-4868_140
DNA Homology
5BL_10920454Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10920454Best IWGSC match
DNA
tgcatataactaccacctagttatttgcttaaattactgcaatgtaccaa
Rttcacaggcacacaaaaagagcacgcaggccatcattcacagtatctgg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.