Query (optional)   in Class  

GrainGenes Sequence Report: GMI_DS_LB_3908

[Submit comment/correction]

Sequence
GMI_DS_LB_3908
Probe
GMI_DS_LB_3908
DNA
ggtcgcgtgagtaacgaacgattagagttttgggcggcggaggggaggag
aggggcttacYgtaggtatgttcgtggcaagggcacgccatggcggggcg
gcggggtttgaagcggagaat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.