Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES01_c17040_394

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES01_c17040_394
Probe
GMI_ES01_c17040_394
DNA
gtgctcattgacggatgttgctccatttggattatagttctgtgaatgaa
ttggtttaggacagtaagaggttgcagatgagcaagcgagcaaaatgatg
Rtcagttctgtaggttgagttgtctcgctcaatcccatttctagatgtaa
tttggatgtagtgttttcagttactcgctgttgaactagtgttttctact
ta
BLAST
BLAST Search