Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES01_c25127_114

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES01_c25127_114
Species
Avena sativa
Probe
GMI_ES01_c25127_114
DNA
cttggatccaagttgctagggcccccaggtatacatcacaaacttcctca
cctttatcccaattccgttgagcgcgttgtctgctcagaatttttcagca
tYcttgtatcttcatcacggagtttcgttatcctagcttcacattggagc
catgaggcagagaaaaatcgccacactgaaggcataaaggccaccgatac
tc
BLAST
BLAST Search