Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES02_c21087_487

[Submit comment/correction]

Sequence
GMI_ES02_c21087_487
Probe
GMI_ES02_c21087
DNA
gggattatctggctctcctgccattagtggacatttcatcatgacttaca
cccttagaaaRcctggatgcagcatttgcacagactagagtagaaaagga
agaaaatgtatgtattgtttt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.