Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES02_c6368_605

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES02_c6368_605
Probe
GMI_ES02_c6368_605
DNA
atgggagcaagcccatccatgttgatcagaagttaattgatggtccaaac
cccaacaatcRctggaagaagtacatacctctcatcctggcggtgcagta
ctttttcgtggtaaaaggaat
BLAST
BLAST Search