Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES02_c8865_394

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES02_c8865_394
Species
Avena sativa
Probe
GMI_ES02_c8865_394
DNA
gtccacgacggcaccaccatcgtgctctgggagtggtgcaagggcgacaa
ccagagctggaagatcctaccctggtaaagcttgatgccgtgtacatgtt
Sgtttccagttcagtagacagaataaacaaccaggtctgcagctacgatc
catggtcagtacgtcacttgacagtcgagatcggatcgcttcgttcacga
at
BLAST
BLAST Search