Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES02_lrc16363_123

[ Printable Version ]  [ Submit comment/correction ]

Sequence
GMI_ES02_lrc16363_123
Species
Avena sativa
Probe
GMI_ES02_lrc16363_123
DNA
tagaatcggaaatctcctcttcagtatgcctatagcatgcctgatatggt
tatgcaggtgtgcatggcgaagattgaacagctccttgtatcccgggaat
tSgaaattgctgtgctcttgctcttgagtatggtaagggaccccgctgta
aggagcaagaaaacaaggcgttgttttggtattaacccttctattcttac
ca
BLAST
BLAST Search