Query (optional)   in Class  

GrainGenes Sequence Report: GMI_ES05_c11331_441

[Submit comment/correction]

Sequence
GMI_ES05_c11331_441
Probe
GMI_ES05_c11331
DNA
cagataatgcccagtgtgtcgtggaagaagatgggtgcgaagccgaagac
ggtctctgttYagaggggagcttagctcggggagctttccttgttatagg
gcagcgcgcctatgtatgatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.